A Combination Treatment with Curcumin and siRNA-directed UBB Silencing Offer Superior Anti-tumorigenic Properties in Breast Cancer

Student: Chae Yeon Lee
Table: MED1203

Display board image not available

Abstract:

Curcumin, the active ingredient in traditional herbal remedies, is a potential agent for both the prevention and treatment of cancers. Small interfering RNA (siRNA) based therapeutics in cancer treatment has also been developed. However, the effect of combination treatment with curcumin and siRNA on breast cancer has never been investigated. To find the target gene of siRNA, the transcriptomic analysis was performed to identify the upregulated genes after curcumin treatment. 191 genes were found to be upregulated in curcumin-treated breast cancer cells. Gene enrichment analysis identified that 12 of the 191 genes were ubiquitin-specific proteases. mRNA expression of Ubiquitin B (UBB), one of the 12 selected genes, was successfully repressed by siUBB. The combination of curcumin and siUBB significantly lowered breast cancer cell viability in comparison with treating with curcumin alone. These results indicate that the combination of curcumin treatment with RNA-based therapies could be more beneficial in treating breast cancer.


Bibliography/Citations:

No additional citations

Additional Project Information

Project website: -- No project website --
Project web pages: -- No webpages provided --
Presentation files: -- No files provided --
Research paper:
Additional Resources: -- No resources provided --
Project files: -- No files provided --
 

Research Plan:

 

Research Plan

Name:  Ashley Chae Yeon Lee
School:  The Lawrenceville School 

Adult Sponsor: Dr. Woo Rin Lee

Project Title: A Combination Treatment with Curcumin and siRNA-directed UBB Silencing Offer Superior Anti-tumorigenic  Properties in Breast Cancer

A. Rationale:

 

Anticancer agents kill the cancerous cells through apoptotic signaling pathway [1]. In comparison to other inducers of apoptosis in cancer, curcumin targets only cancer cells, leaving healthy cells unaffected [2]. Furthermore, curcumin can suppress glioma angiogenesis and induce G2/M cell cycle arrest [3]. However, due to its low aqueous solubility, curcumin is susceptible to alkaline degradation [3]. Currently, this limitation of curcumin is overcome by combination treatment with many different types of nanocarriers [4]. Another limitation of curcumin treatment is that it alone cannot effectively kill cancer cells. Previous studies identified that curcumin treatment upregulates UBB expression in breast cancer cells [5]. However, other studies indicated that UBB promotes cell proliferation and inhibits apoptosis [6]. Therefore, this study proposes that UBB is responsible for curcumin’s inefficacy. One effective approach would be to identify and to downregulate genes that counteract curcumin’s apoptotic activity using small interfering RNAs (siRNAs) to increase the sensitivity of tumor cells to cell death. This study proposes that UBB counteracts curcumin-induced death and that combination treatment of curcumin and siUBB improve anti-cancer effects.

 

B. Hypothesis(es), Research Question(s), (note: you do not need to have all of these – choose only those that are applicable)

 

Question

How can we overcome the limitations of curcumin treatment—its low aqueous solubility and alkaline degradation—in order to enhance chemotherapy’s efficacy in breast cancer treatment? 

 

Hypothesis 

Ubiquitin B (UBB) offers cancer cell protection against the cellular stress induced by anticancer agents including curcumin. Therefore, it is hypothesized that if the expression of UBB gene is repressed by siRNA-mediated cancer gene therapy, then the combination treatment of siUBB and curcumin will significantly lower the viability of breast cancer cells. 

 

Variable 

Independent Variable: Silencing of UBB gene  

 

Dependent Variable: Viability of breast cancer cells upon curcumin treatment 

 

Controls:

  • the conditions which breast cancer cells grow (temperature, type of culture medium, etc)
  • the procedures of plating the cancer cells
  • the procedures of performing viability assay
  • the procedures of treating cells with curcumin
  • the length of time which cancer cells were treated with curcumin 
  • the concentration of curcumin treated 
  • the type of breast cancer cell line (HCC38)
  • the amount of cells to be treated with drug
  • the primer sequence for quantifying UBB expression
  • the targeted gene: UBB

 

C.  Research Methods/Project Summary

  • Materials and Equipment: 

 

Gene Ontology Analysis

  • Functional enrichment analysis tool (FUNRICH)

Cell Culture:

  • RPMI medium (Gibco) 
  • DMSO (Sigma-Aldrich‎)
  • FBS (Hyclone)
  • Trypsin (Gibco)
  • PS (Penicillin streptomycin) (Gibco)
  • PBS (Gibco)

siRNA Transfection:

  • RNAimax (invitrogen) 
  • siRNA targeting UBB (Bioneer)

Cell Viability:

  • Trypsin (Gibco)
  • Luna-FL Dual Fluorescence Cell Counter (Logos Biosystems)
  • acridine orange/propidium iodide (Logos Biosystems)

RT-PCR Reaction:

  • RNA-spin™ Total RNA Extraction Kit (Intron)
  • TOPscript™ Reverse Transcriptase (Enzynomics)
  • forward/reverse primers

UBB: F1: GGGCGGTTGGCTTTGTT R1: CTGGACAATCGCCTATGGTCCTA 

PUM1: F1: TGAGGTGTGCACCATGAAC R1: CAGAATGTGCTTGCCATAGG

  • cDNA
  • SYBR green master mix (Bioneer)
  •  RNase Free dH2O

Basic Equipment:

  • Biosafety cabinet
  • Incubator
  • Dishes
  • Serological pipette
  • Pipette
  • Pipette tips 
  • Microscope
  • Ethanol
  • Well plates (6, 24, 96, 384)
  • Centrifuge tubes (15mL, 50mL)
  • Centrifuge 
  • Vortex machine

 

  • Procedures:

 

Gene Ontology Analysis 191 genes were analyzed using the functional enrichment analysis tool (FUNRICH). Gene enrichment analysis was conducted for identifying molecular function. Gene ontology was ranked according to the p-value. p<0.05 was considered statistically significant. 

Cell Culture Breast cancer cells were routinely cultured in RPMI medium (Gibco) supplemented with 10% inactivated FBS (Hyclone), 100 U/mL penicillin and 100 μg/mL streptomycin (Gibco). Cells were maintained at 37°C in a 5% CO2 humidified environment and prepared for experimental procedures when in log-phase growth.

siRNA Transfection Cells were transfected with anti-target siRNA using lipofectamine RNAimax reagent (Invitrogen) with 1:3 ratio of siRNA (μg) to lipofectamine (μl).

Cell Viability Test The cells were trypsinized at indicated days and the percentage of viable cells was measured by counting cells, which were stained by acridine orange/propidium iodide, an apoptosis indicator, with the Luna-FL Dual Fluorescence Cell Counter (Logos Biosystems). 

RT-PCR reaction RNA was extracted from breast cancer cell lines by RNA-spin™ Total RNA Extraction Kit (Intron) following the manufacturer's instructions. cDNA was synthesized from the extracted RNA using TOPscript™ Reverse Transcriptase (Enzynomics) following the manufacturer’s instructions. For the preparation for the qPCR reaction, 20 µL reaction was prepared containing 2µL forward/reverse primers (10pmol), 0.5µL cDNA, 10µL SYBR green master mix, and RNase Free dH2O up to 20 µL. qPCR was done with annealing temperature 60°C and an extension time of 40 seconds in 72°C for 40 cycles. PUM1 was used for normalizing the expression of UBB.

 

  • Risk and Safety:

Be aware of contamination and mix of cell lines. Wear proper PPE at all times.

Detailed precautions and disposal methods see Addendum B – Safety Data Sheet.
 

  • Data Analysis: 

Gene ontology was performed with functional enrichment analysis tool (FUNRICH). All quantification data were analyzed by t-test in Microsoft Excel.


 

D.  Bibliography: 

References

[1]    W. An, H. Lai, Y. Zhang, M. Liu, X. Lin, and S. Cao, “Apoptotic pathway as the therapeutic target for anticancer traditional chinese medicines.,” Front. Pharmacol., vol. 10, p. 758, Jul. 2019.

[2]    J. Ravindran, S. Prasad, and B. B. Aggarwal, “Curcumin and cancer cells: how many ways can curry kill tumor cells selectively?,” AAPS J., vol. 11, no. 3, pp. 495–510, Sep. 2009.

[3]    H. Batra, S. Pawar, and D. Bahl, “Curcumin in combination with anti-cancer drugs: A nanomedicine review.,” Pharmacol. Res., vol. 139, pp. 91–105, 2019.

[4]    M. Kharat, Z. Du, G. Zhang, and D. J. McClements, “Physical and chemical stability of curcumin in aqueous solutions and emulsions: impact of ph, temperature, and molecular environment,” J. Agric. Food Chem., vol. 65, no. 8, pp. 1525–1532, Mar. 2017.

[5]    J. A. Colacino, S. P. McDermott, M. A. Sartor, M. S. Wicha, and L. S. Rozek, “Transcriptomic profiling of curcumin-treated human breast stem cells identifies a role for stearoyl-coa desaturase in breast cancer prevention.,” Breast Cancer Res. Treat., vol. 158, no. 1, pp. 29–41, Jun. 2016.

[6]    Y. Tang, Y. Geng, J. Luo, W. Shen, W. Zhu, C. Meng, M. Li, X. Zhou, S. Zhang, and J. Cao, “Downregulation of ubiquitin inhibits the proliferation and radioresistance of non-small cell lung cancer cells in vitro and in vivo.,” Sci. Rep., vol. 5, p. 9476, Mar. 2015.

[7]    K. Flick and P. Kaiser, “Protein degradation and the stress response.,” Semin. Cell Dev. Biol., vol. 23, no. 5, pp. 515–522, Jul. 2012.

[8]    C. Oh, S. Park, E. K. Lee, and Y. J. Yoo, “Downregulation of ubiquitin level via knockdown of polyubiquitin gene Ubb as potential cancer therapeutic intervention.,” Sci. 

 

Potentially Hazardous Biological Agents (if applicable*)
*This portion of the plan is required if the Rules Wizard indicates that Form 6A and/or 6B is/are needed.

Biosafety Level Assessment:   

Place an “X” beside one:     ___x__ BSL – 1 _____ BSL – 2           (BSL-3 and -4 are not permitted)

Attach documentation verifying biosafety level as an addendum to your paperwork packet.  Do this with a paper clip or binder clip at the very end of your packet. Do not paste documentation into this form. Do not attach documentation directly to your research plan.
One or more printouts from reputable websites on biosafety level is sufficient.
We recommend starting with ATCC.org

Source of agent, cell line, etc: HCC38

 

 

 Image removed.





 

Safety Precautions:

Work in a BSL-2 laboratory at University of Suwon under the direction of my supervisor, abiding by standard safety procedures and using appropriate PPE such as gloves, lab coat, etc. A biosafety cabinet will be used when required. Avoid contact with skin, eyes and clothing. Keep away from food and drinks. Wash hands immediately after handling the product.

Open only under a sterile workbench.

 

Methods of Disposal:

Disposal will be in accordance with the disposal plan at SuWon University and will occur at the direction of my supervisor. Where appropriate, I will autoclave at 121 degrees Celsius for 20 minutes, use a 10% bleach solution, and/ or biohazard bags.

 

Hazardous Chemicals, Activities, and Devices Research (if applicable*)
*This portion of the plan is required if the Rules Wizard indicates that Form 3 is needed.

Attach documentation verifying risk assessment as an addendum to your paperwork packet.  Do this with a paper clip or binder clip at the very end of your packet. Do not paste documentation into this form. Do not attach documentation directly to your research plan.
One or more printouts from reputable websites is sufficient.
We recommend starting by searching online archives of MSDS / SDS.

 

Risk Assessment Process and Results:

Source of SDS indicated in parenthesis.

 

  • RPMI medium (Gibco) 
  • DMSO (Sigma-Aldrich‎)
  • FBS (Hyclone)
  • Trypsin (Gibco)
  • PS (Penicillin streptomycin) (Gibco)
  • PBS (Gibco)
  • Ethanol (ThermoFisher Scientific)
  • DMSO (ThermoFisher Scientific)
  • Bleach (The Clorox Company)

 

Chemical Concentrations/Drug Dosages:

  • Ethanol: 70%
  • DMSO: 10% diluted in DMEM
  • Trypsin: 0.25%
  • PS (Penicillin Streptomycin): 1%
  • Bleach: 100%

 

Safety Precautions/Procedures:

Abide by standard safety procedures and use appropriate PPE such as goggles, gloves. Apron/lab coat, etc.

 

Methods of Disposal:

Adhere to the SuWon University’s disposal plan and training received by my supervisor.

 

Addendum B – Safety Data Sheet:

All SDSs are saved in the link below at Google Drive.

https://drive.google.com/open?id=10imxBSL0KHJbUpDweQXh88JjVK_7re2H